Phage Therapy (Biocontrol*): Light and Shade Visit new site : Sellanophagetherapy.blogspot.com: 01/08/2010

Saturday, 28 August 2010

First: phiMmar01

Why?

MU prophages

By Artemis :

By Mauve:

By Gepard :

phiMmar01/phiMmar01

phiMU01/phiMmar01

phiMU02/phiMmar01

MU and Mmar Prophages

Integrase Comparison

Saturday, 21 August 2010

Going in search of phages for Mycobacterium ulcerans

This is my opinion about the question.

In practice at the moment I do not have the possibility to search phages for Mycobacterium ulcerans but, if I do not have real phages, however, I can study all potential phages (prophages) inside Mycobacterium marinum and Mycobacterium ulcerans genome.

1-If I find some correlations among "prophages" of these Mycobacteria I have further evidence that M. ulcerans is originated from M.marinum.

2-If I find some correlations between "prophages" of these Mycobacteria I have further evidence that specific phages for M. ulcerans and M.marinum could exist.

I quote the passage from:

Insights from the complete genome sequence of
Mycobacterium marinum on the evolution of Mycobacterium tuberculosis

"...and 10 putative prophages, named phiMmar01–10 (Supplemental Table 2)."

I will study these potential "prophages" one by one.

Tuesday, 17 August 2010

Mycobacterium ulcerans strain Agy99 and its 174-kb pMUM001 plasmid

I quote the passages from:

Giant plasmid-encoded polyketide synthases produce the macrolide toxin of Mycobacterium ulcerans

"...MU contains a 174-kb plasmid, pMUM001, bearing a cluster of genes encoding giant polyketide synthases (PKSs), and polyketide-modifying enzymes, and demonstrate that these are necessary and sufficient for mycolactone synthesis."

"...reflects the acquisition of pMUM001 by horizontal transfer."

"...The 12-membered core of mycolactone is produced by two giant, modular PKSs,
MLSA1 (1.8 MDa) and MLSA2 (0.26 MDa), whereas its side chain is synthesized by MLSB (1.2 MDa), a third modular PKS highly related to MLSA1."

"...There is an extreme level of sequence identity within the different domains of the MLS cluster (>97% amino acid identity), so much so that the 16 ketosynthase domains seem functionally identical."

"..confirming the existence in MU of a circular plasmid, designated pMUM001, comprising 174,155 bp, with a GC content of 62.8% and carrying 81 protein-coding DNA sequences."

"..Replication seems to be initiated by the predicted product of repA, which shares
68.3% amino acid identity with RepA from the cryptic Mycobacterium fortuitum plasmid, pJAZ38 (10)"

"..Two different direct repeat regions were identified 500–1,000 bp upstream of repA, suggesting possible replication origins (ori). GC-skew plots [(G - C) (G+ C)], which highlight compositional biases between leading and lagging DNA strands, displayed a random pattern and did not help pinpoint a possible ori (Fig. 2)."

"..Approximately 2 kb downstream of repA is parA, a gene encoding a chromosome partitioning protein, required for plasmid segregation on cell division. In this region, there is also a potential regulatory gene cluster composed of a serine threonine protein kinase (mup008), a gene encoding a protein of unknown function(mup018) but containing a phosphopeptide recognition domain,a domain found in many regulatory proteins (11), and a WhiB like transcriptional regulator (mup021)."

"...The plasmid is rich in insertion sequences (IS), with 26 examples, including
4 copies of IS2404 and 8 copies of IS2606 (13)."

Circular presentation of pMUM001:

My contribution to pMUM001 plasmid seen from a new perspective by Dot-plot analysis :

by virtual 2G gel:

PKS,polyketide synthase
KS, ketosynthase
TE, thioesterase

by UGENE

D29 phage integrase, L5 phage integrase and Prophage integrase of M.ulcerans comparison

Hypotesis

"If phiMU01 and phiMU02 prophages were mycobacterium phages probably they have some common features with Phage integrase of L5 and D29 mycobacterium phages ".

If this hypotesis is true in that case I can hope against hope.

This analysis will reinforce my conviction about the presence in the soil , fresch water or in other sources of specific phages for Mycobacterium ulcerans. I am sure "nothing seek, nothing find".

By Artemis software I have extracted :

-phiMU01 and phiMU02 prophage integrase sequences from Mycobacterium ulcerans genome.

>misc_feature misc_feature Prophage phiMU01 523696:542119 forward
CCTTGCCGATAGACGGTACCGGCGCGCCCTGACGGGA
CGCGAACGATCAAGAAGCTACCCGCGCCGGTGTCGCT
GGACGGCACTCTAATAACGTCGCGGCTCGCTGGCGTT
GGAATTCAG..........AATC

MUL 0529

>misc_feature misc_feature Prophage phiMU02 3582899:3606951 reverse
GTCAAGTGGTCGCAGGTTCAAATCCTGTCAGCCCGACCA
GAACGTTCTTACTCAAACCAGTGACCGAAAAGACACCGG
CCAAGGTGAGCGACTCCGTTCCGGTGGATCTAGGAGCC
CCTG......ACAT

MUL 3230

-phage integrase sequences from L5 and D29 Mycobacterium phage genome .

L5p33

D29p32

L5p33 DNA/D29p32 Dna Dot plot

MUL 0529 DNA / MUL 3230 DNA Dot plot

MUL 3230 Protein / MUL 0529 Protein Dot plot

MUL 0529 DNA / L5p33 DNA Dot plot

MUL 0529 Protein / L5p33 Protein Dot plot

MUL 0529 Protein / D29p32 Protein Dot plot

MUL 3230 DNA / L5p33 DNA Dot plot

MUL 3230 Protein / L5p33 Protein Dot plot

Is this hypotesis true ? In that case I can hope against hope.

Yes !!!

DISTANCE

D29p32 and MUL 0529 alignment

L5p33 and MUL 0529 alignment

Integrase and genomes GC Skew

Monday, 16 August 2010

My remarks about Mycobacterium ulcerans genome

Most probably the idea to utilize Phage Therapy in Buruli disease is impracticable.

In the Net there is not any information about this.

In spite of everything I think it is useful to try all possibilities for exploring new forms of drugs in Buruli disease and among these also Phage therapy.

I quote the passages from :

Reductive evolution and niche adaptation inferred from the genome of Mycobacterium ulcerans, the causative agent of Buruli ulcer

".....771 pseudogenes, two bacteriophages, and multiple DNA deletions and rearrangements."

"The two prophages named phiMU01 (18 kb, 18 CDS) and phiMU02 (24 kb, 17 CDS) resemble other mycobacteriophages in overall structure, integrating near tRNA genes and containing CDS associated with replication functions. However, phiMU02 may be non-functional, as several of its genes have been inactivated by multiple IS2606 insertions."

"...and acquisition of foreign genes, often via plasmids or bacteriophage, that confer a fitness advantage in the new environment."

I want to check the passages quoted above because they are not described in details:

1° passage:

"The two prophages named phiMU01 (18 kb, 18 CDS) and phiMU02 (24 kb, 17 CDS) resemble other mycobacteriophages in overall structure, integrating near tRNA genes and containing CDS associated with replication functions."

In the beginning if these prophages were mycobacterium phages probably they have still some common features with other Mycobacterium phage genomes like D29,L5, BXZ2 and TM4.

2° passage:

"...phiMU02 may be non-functional, as several of its genes have been inactivated by multiple IS2606 insertions."

Now to shoot off :

a-For avoiding misunderstandings I have written the words by WIKIPEDIA:

Prophage:

A prophage is a phage genome inserted as part of the linear structure of the DNA chromosome of a bacterium. A temperate phage integrated into the host chromosome or existing as an extrachromosomal plasmid. This is a latent form of a bacteriophage in which the viral genes are incorporated into the bacterial chromosomes without causing disruption of the bacterial cell.

Upon detection of host cell damage, the prophage is excised from the bacterial chromosome in a process called prophage induction. After induction, viral replication begins via the lytic cycle. Prophages are important agents of horizontal gene transfer, and are considered to be part of the mobilome.

Bacteriophage

b-phiMU01 and phiMU02 sequences are extracted from Mycobacterium ulcerans genome by Artemis software :

>misc_feature misc_feature Prophage phiMU01 523696:542119 forward
CCTTGCCGATAGACGGTACCGGCGCGCCCTGACGGGA
CGCGAACGATCAAGAAGCTACCCGCGCCGGTGTCGCT
GGACGGCACTCTAATAACGTCGCGGCTCGCTGGCGTT
GGAATTCAG..........AATC

>misc_feature misc_feature Prophage phiMU02 3582899:3606951 reverse
GTCAAGTGGTCGCAGGTTCAAATCCTGTCAGCCCGACCA
GAACGTTCTTACTCAAACCAGTGACCGAAAAGACACCGG
CCAAGGTGAGCGACTCCGTTCCGGTGGATCTAGGAGCC
CCTG......ACAT

c- each prophage genome is examined and compared with D29, L5,TM4 and BXZ2 genomes by Gepard software:

phiMU01 and phiMU02:

phiMU01 and phiMU01:

phiMU02 and phiMU02:

phiMU01 and D29 phage :

d-by Mauve software and M-GCAT sofware the genomes are compared:

with two phiMU01 and phiMU02 prophages:

with phiMU01, phiMU02 and D29 phage:

The LCB weight sets the minimum number of matching nucleotides identified in a collinear region for that region to be considered true homology versus random similarity.

with phiMU01, phiMU02 and BXZ2 phage:

with phiMU01, phiMU02 and L5 phage:

with phiMU01, phiMU02 and TM4 phage:

with all phages above:

e-Conclusions :

phiMU01 and D29 phage

with all phages above:

This analysis reinforces my conviction about the presence in the soil , fresch water or in other sources of specific phages for Mycobacterium ulcerans. I am sure "nothing seek, nothing find".