In the Net there is not any information about this.
In spite of everything I think it is useful to try all possibilities for exploring new forms of drugs in Buruli disease and among these also Phage therapy.
I quote the passages from :
Reductive evolution and niche adaptation inferred from the genome of Mycobacterium ulcerans, the causative agent of Buruli ulcer
".....771 pseudogenes, two bacteriophages, and multiple DNA deletions and rearrangements."
"The two prophages named phiMU01 (18 kb, 18 CDS) and phiMU02 (24 kb, 17 CDS) resemble other mycobacteriophages in overall structure, integrating near tRNA genes and containing CDS associated with replication functions. However, phiMU02 may be non-functional, as several of its genes have been inactivated by multiple IS2606 insertions."
"...and acquisition of foreign genes, often via plasmids or bacteriophage, that confer a fitness advantage in the new environment."
I want to check the passages quoted above because they are not described in details:
1° passage:
"The two prophages named phiMU01 (18 kb, 18 CDS) and phiMU02 (24 kb, 17 CDS) resemble other mycobacteriophages in overall structure, integrating near tRNA genes and containing CDS associated with replication functions."
In the beginning if these prophages were mycobacterium phages probably they have still some common features with other Mycobacterium phage genomes like D29,L5, BXZ2 and TM4.
2° passage:
"...phiMU02 may be non-functional, as several of its genes have been inactivated by multiple IS2606 insertions."
Now to shoot off :
a-For avoiding misunderstandings I have written the words by WIKIPEDIA:
Prophage:
A prophage is a phage genome inserted as part of the linear structure of the DNA chromosome of a bacterium. A temperate phage integrated into the host chromosome or existing as an extrachromosomal plasmid. This is a latent form of a bacteriophage in which the viral genes are incorporated into the bacterial chromosomes without causing disruption of the bacterial cell.
Upon detection of host cell damage, the prophage is excised from the bacterial chromosome in a process called prophage induction. After induction, viral replication begins via the lytic cycle. Prophages are important agents of horizontal gene transfer, and are considered to be part of the mobilome.
Bacteriophage
b-phiMU01 and phiMU02 sequences are extracted from Mycobacterium ulcerans genome by Artemis software :
>misc_feature misc_feature Prophage phiMU01 523696:542119 forward
CCTTGCCGATAGACGGTACCGGCGCGCCCTGACGGGA
CGCGAACGATCAAGAAGCTACCCGCGCCGGTGTCGCT
GGACGGCACTCTAATAACGTCGCGGCTCGCTGGCGTT
GGAATTCAG..........AATC
>misc_feature misc_feature Prophage phiMU02 3582899:3606951 reverse
GTCAAGTGGTCGCAGGTTCAAATCCTGTCAGCCCGACCA
GAACGTTCTTACTCAAACCAGTGACCGAAAAGACACCGG
CCAAGGTGAGCGACTCCGTTCCGGTGGATCTAGGAGCC
CCTG......ACAT
c- each prophage genome is examined and compared with D29, L5,TM4 and BXZ2 genomes by Gepard software:
phiMU01 and phiMU02:
phiMU01 and phiMU01:
phiMU02 and phiMU02:
phiMU01 and D29 phage :
d-by Mauve software and M-GCAT sofware the genomes are compared:
with two phiMU01 and phiMU02 prophages:
with phiMU01, phiMU02 and D29 phage:
The LCB weight sets the minimum number of matching nucleotides identified in a collinear region for that region to be considered true homology versus random similarity.
with phiMU01, phiMU02 and BXZ2 phage:
with phiMU01, phiMU02 and L5 phage:
with phiMU01, phiMU02 and TM4 phage:
with all phages above:
e-Conclusions :
phiMU01 and D29 phage
with all phages above:
This analysis reinforces my conviction about the presence in the soil , fresch water or in other sources of specific phages for Mycobacterium ulcerans. I am sure "nothing seek, nothing find".
