From:
Development of a PCR Assay for Rapid Diagnosis of Mycobacterium ulcerans Infection
"For the PCR, we isolated an M. ulcerans-specific DNA fragment, 1,109 bp long, which is repeated at least 50 times throughout the genome."
I have verified by "In silico " Restriction Site Analysis the AluI action on M.ulcerans genome.
By AluI I have found 16975 restriction sites and 16976 restriction fragments.
From M.ulcerans genome the position :228378-229743
is corresponding to IS2404 sequence and from the restriction Map the position:228599-229707
is corresponding to one restriction fragment by AluI cut.
Restriction Analysis of IS2404 DNA sequence
I have also verified if the indicated primers were effective:
cggcaggctgaagtaactgcc (MU1)
tgtgcagtgaagtaactgcc (MU2)
but with these primers by FastPCR software I do not have had any results .
On the contrary if I use these primers:
1F2_1_48-69 atctttggtgccgcgctattgg
1R10_1_1135-1156 tcgaaggtgacgtcgcgtatcc
I have had the results:
In silico Primer(s) search for: is2404dnasequenceconsistingof1366bases.
1f2_1_48-69 5'-atctttggtgccgcgctattgg
Position: 48->69 22bp 100% Tm = 60,2°C
5-atctttggtgccgcgctattgg->
||||||||||||||||||||||
actagaaaccacggcgcgataaccccgg
1r10_1_1135-1156 5'-tcgaaggtgacgtcgcgtatcc
Position: 1135<-1156 22bp 100% Tm = 61,8°C
<-cctatgcgctgcagtggaagct-5
||||||||||||||||||||||
ctggatacgcgacgtcaccttcgacgaa
1f2_1_48-69 5'-atctttggtgccgcgctattgg
1r10_1_1135-1156 5'-tcgaaggtgacgtcgcgtatcc
PCR product size: 1109bp